Because negative controls were picked based on similar physico-chemical properties to positive control ligands for control ligand virtual screening, the fact that the first ranking ligand of the control library was a negative control may indicate that it is actually a positive control. The last ranked ligand in the control library was the currently used treatment for amoebiasis. Metronidazole (4173) was not only ranked last, but it also had a low score compared to the top ten ligands ranked from the ChemBridge 3D Diversity library. The low score assigned to metronidazole by the GOLD docking software supports the ambiguity of this treatment. Because the compound has a low affinity for the protein active site, the treatment is accompanied by many undesired side effects and does not always cure the patient. The high scores demonstrated by the top ten compounds ranked from the ChemBridge 3D Diversity library may indicate that these compounds have the potential to be a better treatment for amoebiasis than the current treatment (Table 3). The top ranked novel ligand, 7567450, has a high affinity for the protein active site. Thirteen polar contacts interact with nonpolar and charged residues in the active site. Only one polar contact is shown in PyMOL between the novel ligand and a polar residue, indicating that polar residues may be the least important in the binding of the ligand to the active site. Two aromatic rings on the novel ligand have hydrophobic interactions with several tyrosine residues in the active site and increase the surface area of interaction between the ligand and active site (Fig. 1). Inhibition assays will need to be completed in order to determine how efficiently novel compounds decrease the activity of EhPTP. Additionally, cell-based assays will need to be completed in order to confirm that any compound that inhibits EhPTP can pass through the cell membrane and be delivered into the cell for treatment.
Table 2. Top 10 ranking ChemBridge 3D Diversity library ligands against EhPTP known crystal structure (PDB. 3JS5). Columns show the following categories: rank; score and components that compose the score [S(PLP), S(hbond), S(cho), S(metal), DE(clash), DE(tors), and intcor]; library; Hit2Lead ligand identifier; physico-chemical properties, such as molecular weight (g/mol), LogP, and hydrogen bond donors and acceptors; and whether each ligand follows Lipinski's Rule. Ligand 8 was unable to be identified on the Hit2Lead website. Ligands highlighted in yellow were ordered for testing in inhibition assays against EhPTP.
Table 3. Scoring and Lipinski's Data for novel ligands (Chembridge Diversity 3D library) and control ligands in overall ranked order. Categories include ranking in the library screened, score (and sub scores), library, PubChem identifier (control ligands) or Hit2Lead identifier (novel library), molecular weight (g/mol), LogP, hydrogen bond donors, hydrogen bond acceptors, and whether the compound fulfills Lipinski's Rule of Five. Compounds order for inhibition assays are highlighted in yellow. Top 5 ranking compounds are highlighted in blue.
120042014- Missing week 13 and no analysis or photos of procedures in lab
Week 11, 12, 13
11/21/14
Two more activity assays of EhPTP were completed with increasing amounts of working dilutions with 50 ng/uL and 100 ng/uL concentrations. Absorbance of p-nitrophenyl was measured at 410 nm in order to analyze the activity of EhPTP. In trial one, with increasing concentration of enzyme in samples A-H using a working dilution of 50 ng/uL EhPTP, the result was a steady increase in absorbance (Fig. 3A). Sample E did not follow the trend of increasing absorbance of the other samples. In trial 2, with increasing concentrations of enzyme in samples A-H using a working dilution of 100 ng/uL, the same results as trial 1 were not obtained. Rather than having an increase in absorbance, the majority of samples remained in the 0.8-1.1 range of absorbance (Fig. 3B). However, since the activity and absorbance did not stabilize in a noise region of absorbance, it is possible that the enzyme exhausted the supply of substrate to catalyze the dephosphorylation reaction, rather than reaching its maximum reaction rate. The concentration of sample H (Fig. 3A) will be used to complete future inhibition assays until a different optimal concentration to reach the maximum reaction rate of EhPTP with sufficient substrate is determined.
ab Figure 3. EhPTP phosphatase activity assay absorbance readings for tubes A-H after the stop solution was added to the reaction mixture. Tubes A-H contained increased amounts of enzyme (A: 50 ng/uL working dilution; B: 100 ng/uL working dilution). X-axis shows sample tubes. Absorbance at 410 nm shown on y-axis.
11/17/14
The second activity assay of EhPTP was completed with very high concentrations of all existing protein samples in order to determine that the enzyme was in fact active. Reliable absorbance values were obtained in a range of absorbance not within the noise region. The samples visually turned yellow and indicated that the resulting ion from pNPP hydrolysis (pNP) was present in a readable concentration within each tube. Because the enzyme was determined as being active, enzyme can be completed with working dilutions higher than 2 ng/uL concentration in order to determine the optimal concentration of enzyme to be used for assays.
Figure 2. EhPTP phosphatase activity assay absorbance readings for tubes A-D after the stop solution was added to the reaction mixture. Tubes A-D contained high concentrations of stock enzyme and reached absorbance levels in a reliable range. Tubes A and C contain 25 uL of enzyme from expression trials 1 and 2, respectively, that were stored in 20% glycerol. Tubes B and D contained 50 ul (completed aliquot) of snapfrozen enzyme from expression trials 1 and 2. Absorbance on y-axis and sample tubes on x-axis (should not have st. dev. bars because n=1).
11/6/14
First activity assay of EhPTP was completed. The assay was not successful and did not yield results indicating significant activity of the EhPTP enzyme. The results obtained were in the noise region and indicate that there was no significant reaction occurring in the tubes to yield reliable results and the concentration of enzyme being used in the working dilution most likely needs to be increased. In order to determine that the enzyme is active, another trial of the assay will be completed with a higher concentration of enzyme. The reagent will also be tested to make sure that it is properly indicating hydrolysis in solution by the change of color from clear to yellow. If the second assay is successful, then conditions of the phosphatase assay will be improved in order to produce reliable data in subsequent assay trials.
Figure 1. EhPTP phosphatase activity assay absorbance readings for tubes A-H after the stop solution was added to the reaction mixture. Tubes A-H contained increased amounts of enzyme (2 ng/uL working dilution) and should have showed increasing absorbance. Resulting absorbance values are in the noise region and give unreliable readings. Because absorbance values obtained with Chipper seemed unreliable, absorbance was measured again for the same samples using Luke. Absorbance on y-axis and sample tubes on x-axis (should not have st. dev. bars because n=1).
11/3/14
Three compounds of the 10 top-ranking compounds screened against EhPTP from the first 30K compounds of the Chembridge Diversity 3D library were determined and entered into the gDocs spreadsheet to be ordered for enzyme assays. The three compounds were chosen according to their adherence to Lipinski's Rule.
Table 1. Top 3 compounds chosen according to Lipinski's Rule determined from the best ranking list of Run 2 of virtual screening against the first 30K compounds of the Chembridge Diversity 3D ligand library. These compounds will be ordered to test in inhibition assays.
Week 8, 9, 10
During this time, Virtual Screening of EhPTP vs. Chembridge Diversity 3D library was also completed; images of ligands in the active site are in progress. Additionally, the phosphatase enzyme assay for EhPTP was prepared to be completed at a later time.
10/15/14
An SDS-PAGE gel was run to assess the purity of EhPTP elutions and FPLC product of expression round 2. The results obtained are inconclusive when determining the purity of these samples. Due to poor technique, the glass panes were separated when sample 6 was injected and the sample contaminated the entire gel. In addition, the tank was moved when trying to get the leads to work with the voltage machines. This could have also caused sample to float into other wells. The gel also "smiled" significantly. In lanes 11 and 12, which underwent FPLC, highly pure samples should be seen as single distinct bands; unfortunately, purity of samples cannot be determined.
Figure 1. SDS-PAGE gel of EhPTP expression/purification round 2 processes. Characterization was completed after FPLC
Lane 1: ColorPlus prestained protein ladder (10-230 kDa)
Lane 2: Cell Lysate before induction (S1)
Lane 3: Cell Lysate after induction (S2)
Lane 4: Soluble Fraction (S3)
Lane 5: Flow Through (S4)
Lane 6: Wash (S5)
Lane 7/8: Should be empty
Lane 9: Elution 1 (S6)
Lane 10: Elution 2 (S7)
Lane 11: FPLC 20 kDa protein
Lane 12: FPLC 60 kDa protein
Lane13: Should be empty
1162014- Where is week 8,9,10?
9232014- Fantastic work
Week 5, 6, 7
10/13/14
Docking of control ligands in EhPTP active site were completed using GOLD software. 3 control ligands were not docked because they were 2D structures; therefore, 12 ligands were ranked in the best ranking results table.
Table 1. Preliminary best ranking negative and positive control ligands for EhPTP protein structure.
10/6/14
EhPTP elutions 1 and 2 were concentrated to 1 mL in preparation for FPLC
Figure 1. Protein A-280 Nanodrop Spectrophotometry graph of combined protein elutions 1 and 2 from the second round of expression after being concentrated for FPLC. Trial 1 above shows absorbance of 9.911 and concentration of 9.91 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance. Figure 2. Protein A-280 Nanodrop graph of combined protein elutions 1 and 2 after being concentrated for FPLC. Trial 2 above shows absorbance of 9.906 and concentration of 9.91 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
FPLC was completed after the protein was sufficiently concentrated. Because I waited three days in between chromatography purification and FPLC, there is a high chance that the 60 kDa protein may be EhPTP in trimerized form. Although EhPTP according to the 3JS5 PDB structure is a monomer, other crystallography forms with identical sequencing suggest that my protein can exist as a dimer or trimer. The 20 kDa peak (Fig. 3) represents EhPTP as a monomer while the 60 kDa peak is EhPTP trimerized or an unidentified 60 kDa protein that passed through purification. FPLC should have resulted in a higher purity of EhPTP, which will be evaluated in future steps using an SDS-PAGE gel. Both EhPTP and the 60 kDa protein were concentrated and stored after FPLC.
Figure 3. FPLC results curve for EhPTP purification. Y-axis is absorbance (mAU=milli-absorbance units). X-axis is volume dispensed (mL). Along x-axis, red lines with corresponding numbers indicate in which capless tube an individual sample was dispensed. The solid blue line is the results curve and indicates sample size according to the standard curve (blue dashed line). The left large peak indicated a large protein of approximately 60 kDa while the right peak indicates a smaller concentration of small protein (~20 kDa). Remaining peaks are sample contaminants most likely from a previous FPLC run. Figure 4. Protein A-280 Nanodrop spectrophotometry of pre-concentrated EhPTP after FPLC (small peak). Trial 1 (left) above shows absorbance of 0.613 and concentration of 0.61 mg/ml. Trial 2 (right) above shows absorbance of 0.600 and concentration of 0.60 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
Figure 5. Protein A-280 Nanodrop spectrophotometry of concentrated EhPTP after FPLC (small peak). Trial 1 above shows absorbance of 2.383 and concentration of 2.38 mg/ml. Trial 2 above shows absorbance of 2.406 and concentration of 2.41 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
Figure 6. Protein A-280 Nanodrop spectrophotometry of pre-concentrated unknown 60kDa protein after FPLC (large peak). Trial 1 above shows absorbance of 0.628 and concentration of 0.63 mg/ml. Trial 2 above shows absorbance of 0.664 and concentration of 0.66 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
Figure 7. Protein A-280 Nanodrop spectrophotometry of concentrated unknown 60kDa protein after FPLC (large peak). Trial 1 above shows absorbance of 3.356 and concentration of 3.36 mg/ml. Trial 2 above shows absorbance of 3.355 and concentration of 3.36 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
10/3/14
I completed Ni-NTA metal affinity chromatography purification of the EhPTP sample. EhPTP was purified by binding its encoded histag to nickel beads. This prevented it from flowing through a chromatography column as increasing levels of imidazole washed out cell debris and weakly binding proteins. Because a "high" amount of Ni resin was used to bind to EhPTP, it is possible that unwanted proteins could have binded to excess nickel causing a sample result that was not completely pure.
Unfortunately, I did not keep my sample on ice while it binded to the nickel resin. Because I has ~20 ml of sample, I transferred all of the sample to the column, which holds exactly 20 ml. It was mounted on a rod stand and I did not think to move the column to ice while the protein incubated with the nickel. This could result in a lower yield of protein because it could have denatured at room temperature.
Figure 1. Protein A-280 Nanodrop Spectrophotometry graph of protein elution 1 from the second round of expression. Trial 1 above shows absorbance of 5.427 and concentration of 5.43 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance. Figure 2. Protein A-280 Nanodrop Spectrophotometry graph of protein elution 1 from the second round of expression. Trial 2 above shows absorbance of 5.313 and concentration of 5.31 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
Figure 3. Protein A-280 Nanodrop Spectrophotometry graph of protein elution 2 from the second round of expression. Trial 1 above shows absorbance of 0.506 and concentration of 0.51 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance. Figure 4. Protein A-280 Nanodrop Spectrophotometry graph of protein elution 2 from the second round of expression. Trial 2 above shows absorbance of 0.578 and concentration of 0.58 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
9/10/14
SDS-PAGE gel characterization was completed for EhPTP purification using nickel affinity chromatography and expression trial 1. After the gel had been set up, the gel would not run and extensive trouble shooting occurred before the problem was solved. The movement of the tank most likely caused the samples to mix together in the buffer, which caused the sample in each lane to look similar. Additionally, the last two lanes contain sample, when there was no sample injected into the wells of those lanes. The purity of each sample cannot be determined from this gel (Fig. 1). A second gel was run that contained the same samples in addition to the concentrated FPLC sample after further purification. The last lane looks to have a slight hint of sample when none was injected into that well. The sample also look to be highly contaminated. This could be contamination or poor technique could have been used to load these wells. In the second gel (Fig. 2), a band is seen around approximately 60 kDa in addition to the large 20 kDa band. Because a distinct band can be seen, it is possible that the protein is trimerizing.
Figure 1. SDS-PAGE gel characterization of EhPTP nickel chromatography purification samples. Lanes 8 and 9 were not meant to have sample present.
Movement of the tank while the sample were already present in the wells could have caused the samples to mix together. The most concentrated band in the
last samples suggests a high concentration of 20 kDa protein while the more faint band appears to be an unknown 60 kDa protein or EhPTP trimer.
Figure 2. Second trial SDS-PAGE gel characterization of EhPTP expression and purification. Sample present in areas other than in the distinct bands
in lanes 6, 7, and 8, which are supposed to be the most pure samples, suggests significant contamination or poor technique when loading the gels. The
most concentrated band in the last samples suggests a high concentration of 20 kDa protein while the more faint band appears to be an unknown 60 kDa
protein or EhPTP trimer.
09232014- Good job
Week 3/4
9/9/14
I did FPCL on my metal-affinity chromatography purified EhPTP sample. I was not able to complete characterization beforehand to determine the purity of my elution.
Figure 1. Protein A-280 Nanodrop spectrophotometry for EhPTP elution 1, Trial 1 (left) and Trial 2 (right), concentrated in preparation for FPLC. Absorbance readings are 16.485 and 16.484, respectively. Concentrations are 16.49 and 16.48 mg/mL, respectively. On the x-axis is wavelength in nm and on the y-axis is 10mm absorbance.
Figure 2. Protein A-280 Nanodrop spectrophotometry for EhPTP elution 1, Trial 1 (left) and Trial 2 (right), after FPLC purification before being concentrated. Tubes isolated after FPLC for this sample were tubes 47-56. Absorbance readings are 5.555 and 0.614, respectively. Concentrations are 0.55 and 0.61 mg/mL, respectively. On the x-axis is wavelength in nm and on the y-axis is 10mm absorbance.
Figure 3. FPLC results curve for EhPTP purification, Y-axis is absorbance (mAU = milli-absorbance units). X-axis is volume dispensed (ml). Along x-axis, red lines with corresponding numbers indicated in which capless tube an individual sample was dispensed. The solid blue line is the results curve and indicates sample size according to the standard curve (blue dashed line). The left peak (sample curve) indicates a large protein while the right peak indicates a smaller protein.
Larger peak protein size: >44 kDa
Smaller peak protein size: ~20 kDa
Figure 4. Nanodrop spectrophotometry of EhPTP after FPLC. EhPTP was concentrated after FPLC; absorbance was 2.560 while concentration was 2.56 mg/ml at 280 nm. Y-axis shows 10 mm absorbance while x-axis shows wavelength (nm).
----> Total yield and concentration were calculated in Protein Spectrophotometry Calcs spreadsheet
Total concentration: 185.71 uM
Yield: 3.78 mg
Analysis for FPLC:
According to the FPLC Results graph, two peaks are seen (Figure 3.), which indicate two different sized samples. EhPTP was concentrated in the tubes corresponding to the right peak (smaller protein), which has a size of ~20 kDa. FPLC should have, theoretically, further purified my sample from Ni-NTA purification according to size. Purity will be evaluated using SDS-PAGE characterization.
Week 1/2
9/2/14 (Tuesday):
Today Charina, Luis and I went to the Biotech lab to do sonication. Luis and I spun down our samples and kept the supernatant as the product. After sonication, the soluble protein remains in the liquid supernatant. I had to check the pH of my sample to make sure that my protein was at a favorable pH. The pH was at 8.11, which is above the favorable range 7.5-8.0. I added a couple of drops of 1M HCl to my protein, which had a precipitating effect. When my protein began precipitating, I immediately pipetted about three ml off the top of the sample and then spun the sample down at 10,000 g for 15 minutes. The solid was isolated from the sample and I was able to pour off the remaining sample to a new tube.
9/4/14 (Thursday):
I purified my sample using Ni-NTA metal-affinity chromatography. I syringe filtered my protein sample before beginning and also rechecked the pH. When rechecked, the pH was 8.02. After consulting a mentor, we decided that .02 outside of the favorable range was negligible so I continued onto purification. I used 1 ml of Ni-NTA resin/buffer (0.5 ml resin) for binding; however, I was informed that using only 0.5 ml of resin/buffer solution allows better purity since there is less Nickel for contaminating compounds to bind onto. After purification, I nanodropped Elutions 1 and 2 to get their concentration.
Figure 1. Protein A-280 Nanodrop spectrophotometry for EhPTP elution 1, Trial 1 (left) and Trial 2 (right). Absorbance readings are 7.542 and 7.536, respectively, while both concentration reading are 7.54 mg/ml. On the x-axis is wavelength in nm and on the y-axis is 10mm absorbance.
Figure 2. Protein A-280 Nanodrop spectrophotometry for EhPTP elution 2, Trial 1 (left) and Trial 2 (right). Absorbance readings are 0.918 and 0.90, respectively, while concentration readings are 0.92 and 0.90 mg/ml, respectively. On the x-axis is wavelength in nm and on the y-axis is 10mm absorbance. Next Week I will be continuing onto FPLC and characterization.
Summer 2014
Week 9
Monday (7/28):
Today I did PCR cleanup on my new PCR squared DNA samples
Tuesday (7/29)
Received DNA sequencing from Master plate B cultures! Got 8 positive clones!! The BLASTn results (below) were similar for all 8 samples.
I also tried to make LB today for new cell cultures; however, the liquid/bio setting on the autoclave resulted in the LB and LB agar boiling over. We lost both flasks of 500 ml LB agar+Kan. We also lost 2000 ml of LB media.
Figure 1. BLASTn pairwise comparison of EhPTP CDS and returned DNA sequencing results (forward sequence) for Master plate B sample 8.
Figure 2. BLASTn pairwise comparison of EhPTP CDS and returned DNA sequencing results (reverse sequence) for Master plate B sample 8.
Wednesday (7/30)
The autoclave was tested and we found that the liquid/bio setting were altered (must have added some sort of gravity setting). Now we have to use Liquid 6 for autoclaving.
I transformed EhPTP into BL21 (DE3) cells in order to start expression of the protein. The plates had to undergo overnight incubation for at least 16 hours.
Thursday (7/31)
Started small scale cultures early in the morning after picking 8 colonies from the transformation plate. Following "option 2," the cultures incubated for 8 hours and then were used to start a large scale culture. 32 ml (all smal culture tubes) were added to 500 ml of pre- warmed LB to get to an absorbance of 0.1; however, the culture only reached 0.03 and had to go incubation longer than normal to reach 0.5 absorbance. The culture was induced with IPTG and then put on the 25C shaker overnight to incubate. The cells were harvested using centrifugation and then stored in the -80C freezer in lysis/sonication buffer.
Large scale plasmid cultures were also started today by ejecting tips from confirmed cloning samples 7 and 8 into two separate flasks of 160 ml of LB each. They were incubated overnight at 37C for about 16 hours in the shaking incubator.
Friday (8/1)
Midiprepped large scale plasmid cultures.
Week 8
Monday (7/21):
DNA sequencing: I submitted all 9 samples to DNA sequencing using 300 ng of plasmid per sample. I only did forward sequencing to preserve sample since my master plate was contaminated from Friday.
I used a lot of time to do research on my target for my research presentation.
Tuesday (7/22):
Today, I used time to work on my research presentation and collect information for my slides.
Wednesday (7/23):
DNA sequencing results were received: Most of my sequenced samples contain one deletion in identical locations. This leads to the assumption that somewhere at the beginning of primary PCR, one DNa strand experienced a mutation which was amplified into most of my existing EhPTP plasmid. Today I will remake my oligo mix and restart on primary PCR.
I also ran secondary PCR and grew 8 cultures from a preserved Plate B from last week which grew several colonies after the second night of incubation.
Unfortunately I contaminated both my primary and secondary PCR samples, which both worked. I have to find a way to purify my secondary PCR sample of added blue juice so that I can use the sample for PCR squared.
Figure 1. BLASTn pairwaise comparison between Query (CDS) and Subject (DNA sequencing results). Sample 1 was 94% identities due to several unmatched bases and a deletion.
Figure 2. BLASTn pairwise comparison between Query (CDS) and Subject (DNA sequencing results). Sample 3 here shows 99% identities due to a deletion in the subject sequence around base 270. This deletion same deletion was found in all nine samples. This pairwise comparison showed the same result for samples 2-9.
Figure 3. Primary PCR of EhPTP. Lane 1 is a 1 kb ladder while lane two has a sample from a the primary PCR trial. A smear indicates that primary PCR was successful and can be used to continue onto secondary PCR.
Andee Fonseca
7/23/14
Primary PCR
Lane 1: 1 kb ladder
Lane 2: Primary PCR sample
Figure 4. Secondary PCR of EhPTP. Secondary PCR was completed using the primary PCR sample (gel shown above). A distinct band shows that secondary PCR was successful; however, some smearing can be seen, which can indicate contamination or a large amount of DNA in the sample.
Andee Fonseca
07/23/14
Secondary PCR
Lane 1: 1 kb ladder
Lane 2: Secondary PCR sample
Thursday (7/24):
I did another primary and secondary PCR to try to get to PCR squared today but neither PCR trials worked.
Miniprep: I also did miniprep on my Plate B cultures from last night. After nanodrop, the concentrations fell between 58 and 104 ng/uL.
Friday (7/25):
I sent my Plate B samples to DNA sequencing to see if I have a positive clone.
I called Sigma-Aldrich to see what I have to do to purify my secondary PCR sample from Wednesday. Fortunately I can do PCR cleanup, rather than having to do gel extraction, to purify my sample.
Saturday (7/26):
PCR cleanup: I did PCR cleanup on secondary PCR today in hopes that the blue juice will be taken out and I can use a pure sample for PCR squared. Dr. B said PCR cleanup will cause me to lose at least half of my sample. In order to "make up" for this problem. I ran 8 samples of PCR squared hoping that I will still get a large yield of uncontaminated DNA. I also ran a gel to confirm that PCR square worked. On Monday I plan to plate my samples!
Figure 1. PCR squared for EhPTP. Secondary PCR purified with PCR cleanup was used for PCR squared. Distinct bands can be seen for PCR squared samples, indicating that PCR squared was successful.
Andee Fonseca
7/26/14
PCR Squared
Lane 1: 1 kb ladder
Lane 2: PCR squared sample 1
Lane 3: PCR squared sample 2
Lane 4: PCR squared sample 3
Lane 5: PCR squared sample 4
Lane 6: PCR squared sample 5
Lane 7: PCR squared sample 6
Lane 8: PCR squared sample 7
Lane 9: PCR squared sample 8
Lane 10: 1 kb ladder
Week 7
Monday (7/14):
PCR squared: PCR squared was successful for EhPTP and was followed by PCR cleanup. This resulted in approximately 50 uL (103.2 ng/uL) of sample.
Figure 1. PCR Squared for Protein Tyrosine Phosphatase, E. histolytica. Lane 1 is a 1 kb ladder while the following lanes are all 50 ul samples of PCR squared master mix. The template for PCR squared was taken from secondary PCR. Distinct bands for samples A-D indicate that PCR squared was successful.
Andee Fonseca
07/14/14
PCR squared
Lane 1: 1 kb ladder
Lane 2: PCR squared A
Lane 3: PCR squared B
Lane 4: PCR squared C
Lane 5: PCR squared D
Lane 6: empty
Figure 2. Nanodrop spectrophotometry for PCR squared of protein tyrosine phosphatase (Entamoeba histolytica). Trial 1 seen on left with trial 2 on the right. Measured concentrations are 102.8 and 103.5 ng/uL, respectively. Wavelength (nm) shown on x-axis and absorbance shown on y-axis.
Tuesday (7/15):
pNIC-bsa4 preparation as accepting vector: All reagents were doubled due to the amount of pNIC needed for the reaction (27.47 uL of 81.9 ng/uL plasmid). After being digested, pNIC was processed through PCR cleanup and then nanodropped (53.1 ng/uL). A gel was also run to confirm that pNIC was cut in the correct location.
Figure 1. pNIC-bsa4 restriction enzyme digest using BsaI-HF restriction enzyme. Lane 1 is the 1 kb ladder. Lane 2 is the first digested sample (Andee) and Lane 3 is the second digested sample (Zain). The larger band is representative of the digested pNIC backbone that will be used for cohesive end generation and annealing. The smaller segment is the removed SacB gene.
VDS Summer 2014
7/16/2014
Lane 1: 1 kb DNA ladder
Lane 2: Andee's pNIC digested sample
Lane 3: Zain's pNIC digested sample
Wednesday (7/16):
Cohesive End generation: Cohesive end generation was carried out for both insert and vector;however, on the PCR insert, I used Thermo Scientific T4 (5x) DNA polymerase buffer instead of NEbuffer 2. Since we need to use 10X buffer, I doubled the amount of buffer called for in the protocol and adjusted the amount of water accordingly. When I worked with the accepting vector, I used the correct buffer.
Annealing and Transformation: Immediately after cohesive end generation, I did annealing and transformation of the vector and insert at A) 1:2 ratio and B) 3:5 ratio, respectively.
Figure 1. Tranformation plates of EhPTP with pNIC-bsa4 backbone using DH5-alpha on LB agar+Kan+sucrose plates before incubation. DH5-alpha cells produce high levels of encoding DNA. On the left (plate A), the vector and insert are transformed at a 1:2 ratio, respectively. On the right (plate B), vector:insert is a 3:5 ratio. Small white dots can be seen on the plates. These were not visible while the plates were still in the 4C fridge; however, after pre-warming the plates in the incubator for ~30 minutes, these sucrose crystals appeared on the plates and are not to be confused with growth after overnight incubation.
Thursday (7/17):
Overnight growth: After overnight incubation of my A and B transformation plates, I found that the A plate experienced growth and the B plate did not. They were not all distinct colonies however, as the A plate colonies grew in a straight line.
Master plate and cultures: I created my master plate and cultures for 9 samples from my A plate.
Figure 1. Transformation plates of EhPTP with pNIC-bsa4 backbone on LB agar+Kan+sucrose plates after overnight incubation at 37C. On the left (plate A), colonies are visible in a linear pattern of growth. There are approximately 15-16 kanamycin resistant colonies that grew on this plate. On the right (plate B), no growth can be seen. Sucrose crystals are still visible after overnight incubation. Plate B was replaced back into the incubator for a second night in order to facilitate any further growth that could possibly still occur.
Figure 2. Master plate (LB agar+Kan+sucrose) of EhPTP+pNICbsa4 using 9 single colonies from plate A (left) and 9 cultures of corresponding samples to master plate (right). Each culture tube has 5 ml of LB with 5 uL kanamycin. A new 10 uL pipette tip was used to dab a single colony from plate A nine separate times. The tip was then dabbed onto its own number slot on the master plate and then a tip was ejected into a corresponding numbered tube for cultures. Both the master plate and cultures were incubated overnight for 16 hours at 37 degrees celcius, the tubes being placed in the shaking incubator.
Friday (7/18):
Spin down and miniprep: After the 16 hour incubation time, I spun down all 9 of my samples and got significant pellets from each one. After miniprep, I found that the samples ranged in concentration from 56-81 ng/uL.
Figure 1. Nanodrop spectrophotometry for EhPTP samples 1-9. Sample 1 only has 1 trial because two previous nanodrops were completed on protein setting. To acquire a reading, only one more trial was done for Sample 1. All other samples have two trials. Samples ranged in concentration from 56-81 ng/uL.
Week 6
Congrats on your secondary working! Onto PCR squared. How big is your protein? Use the gel and the ladder standard to see if your PCR is the right size. Also, a virtual gel for the RE Digest, just to verify. -Grace
7/15/14
7/7 - 7/8
Monday and Tuesday:
Restriction Enzyme Digest: Today we ran RE Digest. Mine incubated for approximately three hours. Below is the gel ran on 7/8.
Figure 1. Results of agarose gel run of samples of pGBR22 cut with restriction enzymes EcoRI, PvuII, and with both EcoRI and PvuII. In lane 2 is the 1 kb DNA ladder. In lane 3 is the uncut pGBR22 with a concentration of 100 ng. Lanes 4-6 are Andee’s samples of plasmid and restriction enzyme with 4 having only EcoRI, 5 having PvuII, and 6 having both EcoRI and PvuII. The results seen above for these lanes are ideal as there are clear bands in the expected positions based on the segments created after digest with the specific enzyme or enzymes. Lanes 7-9 are Cidia’s samples of plasmid and restriction enzyme with 7 having only EcoRI, 8 having PvuII, and 9 having both EcoRI and PvuII. The results seen above for these lanes are not ideal as there are contaminating bands seen below the first cuts shown in lanes 8 and 9. Other than these bands, the bands shown are appropriate based on the segments created after digest with the specific enzyme or enzymes.
07/08/2014
Cidia Gonzalez / Andee Fonseca
Restriction Enzyme Digest
Lane 1:Empty
Lane 2: 1 kb DNA Ladder
Lane 3: Uncut plasmid pGBR22 (100 ng)
Lane 4: pGBR22 with EcoRI (AndeeF.)
Lane 5: pGBR22 with PvuII (Andee F.)
Lane 6: pGBR22 with EcoRI and PvuII (Andee F.)
Lane 7: pGBR22 with EcoRI (Cidia G.)
Lane 8: pGBR22 with PvuII (Cidia G.)
Lane 9: pGBR22 with EcoRI and PvuII (Cidia G.)
Primary PCR 2nd Run (7/7) and gel (7/8)
Figure 1. Results of Agarose Gel run of primary PCR samples in lanes 3 and 4 for Andee and Cidia and PCR squared samples in lanes 6-9 for Brianna. A 1 kn ladder is shown in lane 2. The results seen in lanes 3 and 4 are not ideal, but do not suggest failure. Light smears are seen which are not undesired results. However, darker smears would be indicative of concentrations high enough to move on to secondary PCR. The PCR Squared samples seen in lanes 6 through 9 are the desired result with possible contamination or uncompleted assembly of the gene seen in several places in each lane. Cidia Gonzalez / Andee Fonseca / Xenia Gonzalez 07/08/2014 Primary PCR / PCR Squared Lane 1: Empty Lane 2: 1 kb DNA Ladder Lane 3: Primary PCR Sample (Andee F.) Lane 4: Primary PCR Sample (Cidia G.) Lane 5: Empty Lane 6: PCR Squared KpblaGES5 (Xenia G.) Lane 7: PCR Squared KpblaGES5 (Xenia G.) Lane 8: PCR Squared KpblaGES5 (Xenia G.) Lane 9: PCR Squared KpblaGES5 (Xenia G.)
On Tuesday 7/8, I also diluted my leading and lagging primers for EhPTP.
Wednesday (7/9):
Primary PCR 3 and Primary PCR 3 gel run:
Figure 1. Results of 3rd Primary PCR of Andee’s sample in lane 3 and Cidia’s sample in lane 4. In lane 2 is a 1 kb DNA Ladder. The absence of any result in lane 3 where Andee’s sample should have shown is most likely a result of improper mixing of the sample before PCR. An additional Primary PCR will need to be done in order to get a result viable enough to use in Secondary PCR. The smear seen in lane 4 is the expected result with a high enough yield to continue on to Secondary PCR.
07/09/14
Primary PCR
Andee F. / Cidia G.
Lane 1: Empty
Lane 2: 1 kB DNA Ladder
Lane 3: Primary PCR Sample (Andee F.)
Lane 4. Primary PCR Sample (Cidia G.)
As a result of the gel for Primary PCR3, I also completed PCR4 to test on Thursday.
Thursday (7/10)
Primary PCR gel 4: (Forgot to save gel to my box - I will upload Monday!) --- This time my PCR worked! I was able to move on to Seconday PCR today.
Secondary PCR:
Figure 1. Secondary PCR samples for Andee, Nikki, Carolyn, and Cidia. The first lane is skipped while the second lane has a 1 kb ladder. Lane three has Andee’s secondary PCR (EhPTP) while the following lanes are Nikki and Carolyn’s secondary PCR and Cidia’s secondary PCR. A visible band is seen for Andee’s samples while the following two samples did not result in bands, indicative that secondary PCR was not successful.
Andee F., Cidia G., Nikki W. and Carolyn T.
07/10/14
Secondary PCR
Lane 1: empty
Lane 2: 1 kb ladder
Lane 3: Andee’s PCR sample
Lane 4: Nikki and Carolyn’s PCR sample
Lane 5: Cidia’s PCR sample
Remaining lanes: empty
Friday (7/11):
Pickle Research Center Field Trip: Such a great experience! LOVED it!
PCR squared: After we got back, I began PCR squared. I didn't have enough time to run the sample and have it finish before I had to leave for work so I made the master mix and then froze the sample. To be continued on monday!
Week 5
Andee - good write up. You don't have to have as much procedural detail - instead weight it more towards results. I like the pictures (your protein gel is great and well labelled. The VisLab pics are great! ) - Dr. B
6/30/14
Monday:
Designing Primers: Today, I designed forward and reverse primers to insert EhPTP (protein tyrosine phosphatase of E. histolytica) into E. coli.
After designing end primers, I created my oligo mix by taking 1 ul out of each of the wells from our ordered DNAworks oligo primers. Each ul was placed into a 1.7 ml microcentrifuge tube by touching the pipette tip to 88 ul of autoclave dH20 that was previously placed in the tube. This amount was determined by subtracting the amount of primers (12) from 100. After adding all of the primers, the mix was pipetted to incorporate all of the samples and then the sample was placed into the -20C freezer.
>filtered DNA sequence with tail ends TACTTCCAATCCATGAAACTGCTGTTCGTTTGCCTGGGTAACATCTGCCGTTCTCCGGCTGCGGAAGCGGTT ATGAAAAAAGTTATCCAGAACCACCACCTGACCGAAAAATACATCTGTGACTCTGCGGGT ACCTGCTCTTACCACGAAGGTCAGCAGGCGGACTCTCGTATGCGTAAAGTTGGTAAATCT CGTGGTTACCAGGTTGACTCTATCTCTCGTCCGGTTGTTTCTTCTGACTTCAAGAACTTT GACTACATCTTCGCGATGGACAACGACAACTACTACGAACTCCTGGACCGTTGCCCGGAA CAGTACAAACAGAAAATCTTCAAAATGGTAGACTTCTGCACCACCATCAAAACCACCGAA GTTCCGGACCCGTACTACGGTGGTGAAAAAGGTTTCCACCGTGTTATCGACATCCTGGAG
GACGCGTGCGAAAACCTGATCATCAAACTGGAAGAAGGTAAACTGATCAACTAACAGTAAAGGTGGATA Caption: Protein Tyrosine Phosphatase CDS code optimized gene sequence. Leading and lagging strands are shown in bold, start codon is green, stop codon is red, and bases from the gene included in the designed primers are shown underlined. All unedited text is not included in the designed primers.
Forward Primer: ’ TACTTCCAATCCATGAAACTGCTGTTCG ’ 28 bp Reverse Primer: ’ GGTAAACTGATCAACTAACAGTAAAGGTGGATA ’ Reverse complement: ’ TATCCACCTTTACTGTTAGTTGATCAGTTTACCTTC ’ 36 bp
7/1/14
Tuesday:
PCR verification: Today I came into lab early to run PCR on two different samples. I ran PCR on pGFP for the second time today because the first PCR did not yield desirable results on an agarose gel last week. I am trying to verify my midi-prep DNA sample through PCR because I couldn't verify it using BLASTn due to the amount of n's that were present in the DNA sequence of pGFP returned from the sequencing core. The sequencing was run two separate times in an attempt to verify the sample.
PCR for pNIC28-bsa4: Concurrently with the first sample, I followed the protocol for pLIC sequencing vectors of pNIC-bsa4. Cidia and I worked together for this protocol due to the fact that we heard one of the pNIC DNA samples we were using was contaminated. I used 36.2 ng/ul while Cidia used 19.6 ng/ul. We created three dilutions (1:10, 1:100, and 1:1000) to keep the concentrations between 0.006 and 6 ng of plasmid per PCR tube. We added the DNA template to the tube in increasing concentration from tube A to tube C while tube D (control) did not contain any DNA. pNIC-bsa4 and pGFP were run at the same time, however on two different blocks due to the fact that they had differing cycling requirements.
FPLC column buffer: After PCR began running through cycles, Cidia and I paired up to make 1L of FPLC column buffer. We made the buffer using 50 mM tris base, 150 mM sodium chloride, and 1 mM DTT. We weren't informed that we needed to make the buffer without DTT so we added DTT found in the cabinet next to the flammables cabinet, rather than the one in the 4C fridge. We then pH'd the solution with HCl, because the buffer was more basic that the desired pH, and the we bottle filter sterilized it. We then degassed it from approximately 15 minutes. However, a couple of times we had to stop the water because the water level reached "overflow." When we turned off the water, we waited for the existing water in the sink to drain. We had to clean lots of water from the bottom cabinet under the sink because there was a huge leak spilling everywheeerreeeee. :(
Oligo Primary PCR: Following the making of the buffer, Cidia and I did oligo PCR, creating a mix with 10 ul 5x buffer, 5 ul 2mM dNTPs, 1 ul of our oligo mix created the previous day, 0.5 Q5 hotstart polymerase, (1U/uL) and 33.5 uL autoclaved dH20 for an ending total of 50 uL. We allowed the mix to cycle according to the PCR overlap with Q5 polymerase protocol. After Journal club, Cidia and I returned to the lab to store our samples, and the tubes had been squished. That was the first time our tubes have ever come out of the PCR machines squished...
7/2/14
Wednesday:
FPLC - size exclusion chromotography: Today we came to lab early to carry out the FPLC size exclusion chromotography protocol.
Primary PCR agarose gel:
pNIC-bsa4 agarose gel:
pGFP agarose gel:
7/3/14
Thursday:
YopH protein concetration by centrifugation:
Week 4
Sorry that this week's wikispaces is backwards, Dr. B! I wrote in the order of days in which I could remember what happened!
6/27/14
Friday
VisLab Tour: VisLab tour was AWESOME and so interesting!
Left: The back side of the large panel of monitors that composes the VisLab supercomputer "monitor." Underneath the monitors there are a bundle of wires that connect to approximately 22 computer "cores."
Right: Nikki and Charina attempt to control the pictures on the supermonitor with a large glass control table.
Drying SDS-PAGE gel: I left early today - not before starting the drying process for my gel, however. I took my gel out from the wash, which did not destain very well since I used new dye. Then I put the gel on Whatman filter paper and covered it with cellophane. I took it over to the dryer and put it under the plastic flap. Next, I turned on the vacuum to remove all air and wrinkles in the plastic to prevent the gel from cracking. Finally I adjusted the drying settings (75C for 2 hours on Gradient cycle) and then started the dryer with mine and Carolyn's gel, along with Andrei and Luis's gel.
AB Figure 1. Electrophoresis characterization SDS-Page gel of yopH protein purification before drying (A) and after drying (B). The first and last lanes are empty to prevent "smiling." Lanes 2 - 8 show samples 0 - 6.
Lane 1: ColorPlus Prestained Protein Ladder (10-230 kDa).
Lane 2: Cell lysate before induction
Lane 3: Cell lysate after induction
Lane 4: Soluble fraction
Lane 5: Flow through
Lane 6: Wash
Lane 7: Elution 1
Lane 8: Elution 2
Much contamination is seen in lanes 2-5. Because the band of protein is so dark in elution 2 (lane 8), we could possibly increase the concentration of imidazole in order to release most of the protein in elution 1 when we first begin eluting. We could also decrease the concentration of imidazole in the wash to decrease competition so that weakly bound yopH is not released before eluting. This should concentrate the yopH in the first elution step. In lane 7, elution one is not one distinct band; however, since lane 6 and lane 8 are distinct bands, the distortion is most likely a problem with the sample running through the gel and not contamination.
6/26/14
Thursday:
PCR for pGFP template attempt 1:
Protein Characterization: Carolyn and I characterized our protein using gel electrophoresis. Our gel was previously made the day before in preparation, so we began by prepping our expression and purification samples (0-6). We centrifuged samples 0 and 1 for 5 minutes at 5000 rpm, retained the pellet, and then resuspended in 200 ul of water. Finally we added 40 ul of loading buffer. For the remaining samples of 50 ul we added a 2:10 ratio of loading buffer (10 ul per sample). We heat blocked all samples for 5 minutes at 95C and then centrifuged them all for 2 minutes at 5000 rpm. We assembled the electrophoresis tank, inserted our gel after removing the comb with another group's gel, and then poured in enough buffer to fill the tank to the fill-line for two gels. We cleared the gel wells with a 20 gauge syringe and needle, loaded 7ul of the colorplus prestained protein ladder (10-230 kDa) into the second lane, and then loaded 20 ul of each sample subsequent lanes.
pGFP agarose gel run 1:
6/25/14
Wednesday:
Creating SDS-PAGE gel:
pGBR22 PCR attempt 2:
pGBR22 agarose gel run 2:
pGFP protein verification attempt:
6/24/14
Tuesday:
Ni-NTA Protein purification of yopH:
Making buffers for SDS-PAGE gel:
pGBR22 PCR attempt 2:
6/23/14
Monday:
Analyzing DNA sequence:
pGBR22 agarose gel run 1: This first gel run was not successful
Week 3
Yikes - is that first plate bubbles? the other two look good. We should run your pGFP plasmid on a gel whenever you run your next PCR gel - so that we can see if there is a contaminating band present. If so, we probably need ot trash that sample. Dr. B
ABC Figure 1. LB agar plates with ampicillin containing DH5-alpha cells and varying amounts of pGFP plamid. Transformation density could not be caculated for plates A and C due to overgrowth. Plate B resulted in 518.4 colonies per ng of plasmid.
DNA Re-Sequencing - PMCHERRY 6/18
Caption: Re-sequencing submission of pmcherry DNA plamid using core facility M13for-20 primer.
Caption: Re-sequencing results received from the DNA sequencing core facility. Pmcherry was re-sequenced using option A with core facility in-house primer M13_for20 primer and then returned with the above results. The core is going to re-run the sample again using option A and "difficult template buffer." Figure 2. Re-sequencing results seen from the view function of order 104387 PMCHERRY. The several different peaks seen under each base symbol may indicate that the plasmid sample experienced contamination, which resulted in poor results received from the core. Several different plamids being present can "confuse" the sequencer, resulting in the several different colored peaks representing different bases from the different plasmids in the sample.
DNA S/equencing - PGFP 6/18
Caption: DNA sequencing submission of pGFP unverified plasmid using core facility sp6 forward primer.
Caption: Sequencing results received from the DNA sequencing core facility. Our plasmid, pGFP, was sequenced using core facility in-house sp6 forward primer with the above results. Currently the sample is being re-run by the core using "difficult template buffer."
Week 1 and 2
Figure 1. Absorbance of pmCherry DNA template at 230 nm wavelength using Nanodrop spectrophotometry nucleic acid setting. Trial 1 resulted in pmCherry absorbance of 1.367 and concentration of 109.9 ng/uL using a 10 mm pathway. Wavelength (nm) shown on x-axis and absorbance shown on y-axis. Figure 2. Absorbance of pmCherry DNA template at 230 nm wavelength using Nanodrop spectrophotometry nucleic acid setting. Trial 2 resulted in pmCherry absorbance of 1.297 and concentration of 108.1 ng/uL using a 10 mm pathway. Wavelength (nm) shown on x-axis and absorbance shown on y-axis.
ABC Figure 3. LB-agar plates after overnight incubation period at 37 degrees celsius. Plates contains DH5-alpha bacteria cells with pGFP plasmid on an agar plate with ampicillin. Plates A, B, and C contained 1 ng, 5 ng, and 25 ng of pGFP plasmid, respectively. Ampicillin-resistant colonies experienced substantial growth on all three plates, although they grew the most on plates A and C, which have large cloudy areas of bacterial colonies indistinguishable from one another. Small colonies are visible as whitish-yellow round dots on plate B. Figure 4. This LB-agar plate with ampicillin contained DH5-alpha bacteria with no DNA plasmid. The plate was incubated overnight at 37 degrees celsius and bacteria did not grow due to their vulnerability to ampicillin antibiotic without pGFP present in their DNA.
Caption: First received DNA sequencing results from dnaLIMS. Pmcherry was sequenced using M13_for40 primer and was rerun and then returned with the above results.
Fall 2014
Week 14 and 15
Virtual Screening Analysis of Novel Ligands
Table 2. Top 10 ranking ChemBridge 3D Diversity library ligands against EhPTP known crystal structure (PDB. 3JS5). Columns show the following categories: rank; score and components that compose the score [S(PLP), S(hbond), S(cho), S(metal), DE(clash), DE(tors), and intcor]; library; Hit2Lead ligand identifier; physico-chemical properties, such as molecular weight (g/mol), LogP, and hydrogen bond donors and acceptors; and whether each ligand follows Lipinski's Rule. Ligand 8 was unable to be identified on the Hit2Lead website. Ligands highlighted in yellow were ordered for testing in inhibition assays against EhPTP.
Table 3. Scoring and Lipinski's Data for novel ligands (Chembridge Diversity 3D library) and control ligands in overall ranked order. Categories include ranking in the library screened, score (and sub scores), library, PubChem identifier (control ligands) or Hit2Lead identifier (novel library), molecular weight (g/mol), LogP, hydrogen bond donors, hydrogen bond acceptors, and whether the compound fulfills Lipinski's Rule of Five. Compounds order for inhibition assays are highlighted in yellow. Top 5 ranking compounds are highlighted in blue.
120042014- Missing week 13 and no analysis or photos of procedures in lab
Week 11, 12, 13
11/21/14
- Two more activity assays of EhPTP were completed with increasing amounts of working dilutions with 50 ng/uL and 100 ng/uL concentrations. Absorbance of p-nitrophenyl was measured at 410 nm in order to analyze the activity of EhPTP. In trial one, with increasing concentration of enzyme in samples A-H using a working dilution of 50 ng/uL EhPTP, the result was a steady increase in absorbance (Fig. 3A). Sample E did not follow the trend of increasing absorbance of the other samples. In trial 2, with increasing concentrations of enzyme in samples A-H using a working dilution of 100 ng/uL, the same results as trial 1 were not obtained. Rather than having an increase in absorbance, the majority of samples remained in the 0.8-1.1 range of absorbance (Fig. 3B). However, since the activity and absorbance did not stabilize in a noise region of absorbance, it is possible that the enzyme exhausted the supply of substrate to catalyze the dephosphorylation reaction, rather than reaching its maximum reaction rate. The concentration of sample H (Fig. 3A) will be used to complete future inhibition assays until a different optimal concentration to reach the maximum reaction rate of EhPTP with sufficient substrate is determined.
aFigure 3. EhPTP phosphatase activity assay absorbance readings for tubes A-H after the stop solution was added to the reaction mixture. Tubes A-H contained increased amounts of enzyme (A: 50 ng/uL working dilution; B: 100 ng/uL working dilution). X-axis shows sample tubes. Absorbance at 410 nm shown on y-axis.
11/17/14
Figure 2. EhPTP phosphatase activity assay absorbance readings for tubes A-D after the stop solution was added to the reaction mixture. Tubes A-D contained high concentrations of stock enzyme and reached absorbance levels in a reliable range. Tubes A and C contain 25 uL of enzyme from expression trials 1 and 2, respectively, that were stored in 20% glycerol. Tubes B and D contained 50 ul (completed aliquot) of snapfrozen enzyme from expression trials 1 and 2. Absorbance on y-axis and sample tubes on x-axis (should not have st. dev. bars because n=1).
11/6/14
Figure 1. EhPTP phosphatase activity assay absorbance readings for tubes A-H after the stop solution was added to the reaction mixture. Tubes A-H contained increased amounts of enzyme (2 ng/uL working dilution) and should have showed increasing absorbance. Resulting absorbance values are in the noise region and give unreliable readings. Because absorbance values obtained with Chipper seemed unreliable, absorbance was measured again for the same samples using Luke. Absorbance on y-axis and sample tubes on x-axis (should not have st. dev. bars because n=1).
11/3/14
- Three compounds of the 10 top-ranking compounds screened against EhPTP from the first 30K compounds of the Chembridge Diversity 3D library were determined and entered into the gDocs spreadsheet to be ordered for enzyme assays. The three compounds were chosen according to their adherence to Lipinski's Rule.
Table 1. Top 3 compounds chosen according to Lipinski's Rule determined from the best ranking list of Run 2 of virtual screening against the first 30K compounds of the Chembridge Diversity 3D ligand library. These compounds will be ordered to test in inhibition assays.Week 8, 9, 10
During this time, Virtual Screening of EhPTP vs. Chembridge Diversity 3D library was also completed; images of ligands in the active site are in progress. Additionally, the phosphatase enzyme assay for EhPTP was prepared to be completed at a later time.
10/15/14
Figure 1. SDS-PAGE gel of EhPTP expression/purification round 2 processes. Characterization was completed after FPLC
Lane 1: ColorPlus prestained protein ladder (10-230 kDa)
Lane 2: Cell Lysate before induction (S1)
Lane 3: Cell Lysate after induction (S2)
Lane 4: Soluble Fraction (S3)
Lane 5: Flow Through (S4)
Lane 6: Wash (S5)
Lane 7/8: Should be empty
Lane 9: Elution 1 (S6)
Lane 10: Elution 2 (S7)
Lane 11: FPLC 20 kDa protein
Lane 12: FPLC 60 kDa protein
Lane13: Should be empty
1162014- Where is week 8,9,10?
9232014- Fantastic work
Week 5, 6, 7
10/13/14
- Docking of control ligands in EhPTP active site were completed using GOLD software. 3 control ligands were not docked because they were 2D structures; therefore, 12 ligands were ranked in the best ranking results table.
Table 1. Preliminary best ranking negative and positive control ligands for EhPTP protein structure.10/6/14
Figure 1. Protein A-280 Nanodrop Spectrophotometry graph of combined protein elutions 1 and 2 from the second round of expression after being concentrated for FPLC. Trial 1 above shows absorbance of 9.911 and concentration of 9.91 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
Figure 2. Protein A-280 Nanodrop graph of combined protein elutions 1 and 2 after being concentrated for FPLC. Trial 2 above shows absorbance of 9.906 and concentration of 9.91 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
Figure 3. FPLC results curve for EhPTP purification. Y-axis is absorbance (mAU=milli-absorbance units). X-axis is volume dispensed (mL). Along x-axis, red lines with corresponding numbers indicate in which capless tube an individual sample was dispensed. The solid blue line is the results curve and indicates sample size according to the standard curve (blue dashed line). The left large peak indicated a large protein of approximately 60 kDa while the right peak indicates a smaller concentration of small protein (~20 kDa). Remaining peaks are sample contaminants most likely from a previous FPLC run.
Figure 4. Protein A-280 Nanodrop spectrophotometry of pre-concentrated EhPTP after FPLC (small peak). Trial 1 (left) above shows absorbance of 0.613 and concentration of 0.61 mg/ml. Trial 2 (right) above shows absorbance of 0.600 and concentration of 0.60 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
Figure 5. Protein A-280 Nanodrop spectrophotometry of concentrated EhPTP after FPLC (small peak). Trial 1 above shows absorbance of 2.383 and concentration of 2.38 mg/ml. Trial 2 above shows absorbance of 2.406 and concentration of 2.41 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
Figure 6. Protein A-280 Nanodrop spectrophotometry of pre-concentrated unknown 60kDa protein after FPLC (large peak). Trial 1 above shows absorbance of 0.628 and concentration of 0.63 mg/ml. Trial 2 above shows absorbance of 0.664 and concentration of 0.66 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
Figure 7. Protein A-280 Nanodrop spectrophotometry of concentrated unknown 60kDa protein after FPLC (large peak). Trial 1 above shows absorbance of 3.356 and concentration of 3.36 mg/ml. Trial 2 above shows absorbance of 3.355 and concentration of 3.36 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
10/3/14
Figure 1. Protein A-280 Nanodrop Spectrophotometry graph of protein elution 1 from the second round of expression. Trial 1 above shows absorbance of 5.427 and concentration of 5.43 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.Figure 2. Protein A-280 Nanodrop Spectrophotometry graph of protein elution 1 from the second round of expression. Trial 2 above shows absorbance of 5.313 and concentration of 5.31 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
Figure 3. Protein A-280 Nanodrop Spectrophotometry graph of protein elution 2 from the second round of expression. Trial 1 above shows absorbance of 0.506 and concentration of 0.51 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
Figure 4. Protein A-280 Nanodrop Spectrophotometry graph of protein elution 2 from the second round of expression. Trial 2 above shows absorbance of 0.578 and concentration of 0.58 mg/ml. X-axis shows wavelength (nm) while y-axis shows 10 mm absorbance.
9/10/14
Figure 1. SDS-PAGE gel characterization of EhPTP nickel chromatography purification samples. Lanes 8 and 9 were not meant to have sample present.
Movement of the tank while the sample were already present in the wells could have caused the samples to mix together. The most concentrated band in the
last samples suggests a high concentration of 20 kDa protein while the more faint band appears to be an unknown 60 kDa protein or EhPTP trimer.
Figure 2. Second trial SDS-PAGE gel characterization of EhPTP expression and purification. Sample present in areas other than in the distinct bands
in lanes 6, 7, and 8, which are supposed to be the most pure samples, suggests significant contamination or poor technique when loading the gels. The
most concentrated band in the last samples suggests a high concentration of 20 kDa protein while the more faint band appears to be an unknown 60 kDa
protein or EhPTP trimer.
09232014- Good job
Week 3/4
9/9/14
Figure 1. Protein A-280 Nanodrop spectrophotometry for EhPTP elution 1, Trial 1 (left) and Trial 2 (right), concentrated in preparation for FPLC. Absorbance readings are 16.485 and 16.484, respectively. Concentrations are 16.49 and 16.48 mg/mL, respectively. On the x-axis is wavelength in nm and on the y-axis is 10mm absorbance.
Figure 2. Protein A-280 Nanodrop spectrophotometry for EhPTP elution 1, Trial 1 (left) and Trial 2 (right), after FPLC purification before being concentrated. Tubes isolated after FPLC for this sample were tubes 47-56. Absorbance readings are 5.555 and 0.614, respectively. Concentrations are 0.55 and 0.61 mg/mL, respectively. On the x-axis is wavelength in nm and on the y-axis is 10mm absorbance.
Figure 3. FPLC results curve for EhPTP purification, Y-axis is absorbance (mAU = milli-absorbance units). X-axis is volume dispensed (ml). Along x-axis, red lines with corresponding numbers indicated in which capless tube an individual sample was dispensed. The solid blue line is the results curve and indicates sample size according to the standard curve (blue dashed line). The left peak (sample curve) indicates a large protein while the right peak indicates a smaller protein.
Larger peak protein size: >44 kDa
Smaller peak protein size: ~20 kDa
Figure 4. Nanodrop spectrophotometry of EhPTP after FPLC. EhPTP was concentrated after FPLC; absorbance was 2.560 while concentration was 2.56 mg/ml at 280 nm. Y-axis shows 10 mm absorbance while x-axis shows wavelength (nm).
----> Total yield and concentration were calculated in Protein Spectrophotometry Calcs spreadsheet
Total concentration: 185.71 uM
Yield: 3.78 mg
Analysis for FPLC:
According to the FPLC Results graph, two peaks are seen (Figure 3.), which indicate two different sized samples. EhPTP was concentrated in the tubes corresponding to the right peak (smaller protein), which has a size of ~20 kDa. FPLC should have, theoretically, further purified my sample from Ni-NTA purification according to size. Purity will be evaluated using SDS-PAGE characterization.
Week 1/2
9/2/14 (Tuesday):
- Today Charina, Luis and I went to the Biotech lab to do sonication. Luis and I spun down our samples and kept the supernatant as the product. After sonication, the soluble protein remains in the liquid supernatant. I had to check the pH of my sample to make sure that my protein was at a favorable pH. The pH was at 8.11, which is above the favorable range 7.5-8.0. I added a couple of drops of 1M HCl to my protein, which had a precipitating effect. When my protein began precipitating, I immediately pipetted about three ml off the top of the sample and then spun the sample down at 10,000 g for 15 minutes. The solid was isolated from the sample and I was able to pour off the remaining sample to a new tube.
9/4/14 (Thursday):Figure 1. Protein A-280 Nanodrop spectrophotometry for EhPTP elution 1, Trial 1 (left) and Trial 2 (right). Absorbance readings are 7.542 and 7.536, respectively, while both concentration reading are 7.54 mg/ml. On the x-axis is wavelength in nm and on the y-axis is 10mm absorbance.
Figure 2. Protein A-280 Nanodrop spectrophotometry for EhPTP elution 2, Trial 1 (left) and Trial 2 (right). Absorbance readings are 0.918 and 0.90, respectively, while concentration readings are 0.92 and 0.90 mg/ml, respectively. On the x-axis is wavelength in nm and on the y-axis is 10mm absorbance.
Next Week I will be continuing onto FPLC and characterization.
Summer 2014
Week 9
Monday (7/28):
- Today I did PCR cleanup on my new PCR squared DNA samples
Tuesday (7/29)Figure 1. BLASTn pairwise comparison of EhPTP CDS and returned DNA sequencing results (forward sequence) for Master plate B sample 8.
Figure 2. BLASTn pairwise comparison of EhPTP CDS and returned DNA sequencing results (reverse sequence) for Master plate B sample 8.
Wednesday (7/30)
Thursday (7/31)
Friday (8/1)
Week 8
Monday (7/21):
- DNA sequencing: I submitted all 9 samples to DNA sequencing using 300 ng of plasmid per sample. I only did forward sequencing to preserve sample since my master plate was contaminated from Friday.
- I used a lot of time to do research on my target for my research presentation.
Tuesday (7/22):- Today, I used time to work on my research presentation and collect information for my slides.
Wednesday (7/23):Figure 1. BLASTn pairwaise comparison between Query (CDS) and Subject (DNA sequencing results). Sample 1 was 94% identities due to several unmatched bases and a deletion.
Figure 2. BLASTn pairwise comparison between Query (CDS) and Subject (DNA sequencing results). Sample 3 here shows 99% identities due to a deletion in the subject sequence around base 270. This deletion same deletion was found in all nine samples. This pairwise comparison showed the same result for samples 2-9.
Figure 3. Primary PCR of EhPTP. Lane 1 is a 1 kb ladder while lane two has a sample from a the primary PCR trial. A smear indicates that primary PCR was successful and can be used to continue onto secondary PCR.
Andee Fonseca
7/23/14
Primary PCR
Lane 1: 1 kb ladder
Lane 2: Primary PCR sample
Figure 4. Secondary PCR of EhPTP. Secondary PCR was completed using the primary PCR sample (gel shown above). A distinct band shows that secondary PCR was successful; however, some smearing can be seen, which can indicate contamination or a large amount of DNA in the sample.
Andee Fonseca
07/23/14
Secondary PCR
Lane 1: 1 kb ladder
Lane 2: Secondary PCR sample
Thursday (7/24):
Friday (7/25):
Saturday (7/26):
Figure 1. PCR squared for EhPTP. Secondary PCR purified with PCR cleanup was used for PCR squared. Distinct bands can be seen for PCR squared samples, indicating that PCR squared was successful.
Andee Fonseca
7/26/14
PCR Squared
Lane 1: 1 kb ladder
Lane 2: PCR squared sample 1
Lane 3: PCR squared sample 2
Lane 4: PCR squared sample 3
Lane 5: PCR squared sample 4
Lane 6: PCR squared sample 5
Lane 7: PCR squared sample 6
Lane 8: PCR squared sample 7
Lane 9: PCR squared sample 8
Lane 10: 1 kb ladder
Week 7
Monday (7/14):
Figure 1. PCR Squared for Protein Tyrosine Phosphatase, E. histolytica. Lane 1 is a 1 kb ladder while the following lanes are all 50 ul samples of PCR squared master mix. The template for PCR squared was taken from secondary PCR. Distinct bands for samples A-D indicate that PCR squared was successful.
Andee Fonseca
07/14/14
PCR squared
Lane 1: 1 kb ladder
Lane 2: PCR squared A
Lane 3: PCR squared B
Lane 4: PCR squared C
Lane 5: PCR squared D
Lane 6: empty
Figure 2. Nanodrop spectrophotometry for PCR squared of protein tyrosine phosphatase (Entamoeba histolytica). Trial 1 seen on left with trial 2 on the right. Measured concentrations are 102.8 and 103.5 ng/uL, respectively. Wavelength (nm) shown on x-axis and absorbance shown on y-axis.
Tuesday (7/15):
Figure 1. pNIC-bsa4 restriction enzyme digest using BsaI-HF restriction enzyme. Lane 1 is the 1 kb ladder. Lane 2 is the first digested sample (Andee) and Lane 3 is the second digested sample (Zain). The larger band is representative of the digested pNIC backbone that will be used for cohesive end generation and annealing. The smaller segment is the removed SacB gene.
VDS Summer 2014
7/16/2014
Lane 1: 1 kb DNA ladder
Lane 2: Andee's pNIC digested sample
Lane 3: Zain's pNIC digested sample
Wednesday (7/16):
Figure 1. Tranformation plates of EhPTP with pNIC-bsa4 backbone using DH5-alpha on LB agar+Kan+sucrose plates before incubation. DH5-alpha cells produce high levels of encoding DNA. On the left (plate A), the vector and insert are transformed at a 1:2 ratio, respectively. On the right (plate B), vector:insert is a 3:5 ratio. Small white dots can be seen on the plates. These were not visible while the plates were still in the 4C fridge; however, after pre-warming the plates in the incubator for ~30 minutes, these sucrose crystals appeared on the plates and are not to be confused with growth after overnight incubation.
Thursday (7/17):
Figure 1. Transformation plates of EhPTP with pNIC-bsa4 backbone on LB agar+Kan+sucrose plates after overnight incubation at 37C. On the left (plate A), colonies are visible in a linear pattern of growth. There are approximately 15-16 kanamycin resistant colonies that grew on this plate. On the right (plate B), no growth can be seen. Sucrose crystals are still visible after overnight incubation. Plate B was replaced back into the incubator for a second night in order to facilitate any further growth that could possibly still occur.
Figure 2. Master plate (LB agar+Kan+sucrose) of EhPTP+pNICbsa4 using 9 single colonies from plate A (left) and 9 cultures of corresponding samples to master plate (right). Each culture tube has 5 ml of LB with 5 uL kanamycin. A new 10 uL pipette tip was used to dab a single colony from plate A nine separate times. The tip was then dabbed onto its own number slot on the master plate and then a tip was ejected into a corresponding numbered tube for cultures. Both the master plate and cultures were incubated overnight for 16 hours at 37 degrees celcius, the tubes being placed in the shaking incubator.
Friday (7/18):
Figure 1. Nanodrop spectrophotometry for EhPTP samples 1-9. Sample 1 only has 1 trial because two previous nanodrops were completed on protein setting. To acquire a reading, only one more trial was done for Sample 1. All other samples have two trials. Samples ranged in concentration from 56-81 ng/uL.
Week 6
Congrats on your secondary working! Onto PCR squared. How big is your protein? Use the gel and the ladder standard to see if your PCR is the right size. Also, a virtual gel for the RE Digest, just to verify. -Grace
7/15/14
7/7 - 7/8
Monday and Tuesday:
Figure 1. Results of agarose gel run of samples of pGBR22 cut with restriction enzymes EcoRI, PvuII, and with both EcoRI and PvuII. In lane 2 is the 1 kb DNA ladder. In lane 3 is the uncut pGBR22 with a concentration of 100 ng. Lanes 4-6 are Andee’s samples of plasmid and restriction enzyme with 4 having only EcoRI, 5 having PvuII, and 6 having both EcoRI and PvuII. The results seen above for these lanes are ideal as there are clear bands in the expected positions based on the segments created after digest with the specific enzyme or enzymes. Lanes 7-9 are Cidia’s samples of plasmid and restriction enzyme with 7 having only EcoRI, 8 having PvuII, and 9 having both EcoRI and PvuII. The results seen above for these lanes are not ideal as there are contaminating bands seen below the first cuts shown in lanes 8 and 9. Other than these bands, the bands shown are appropriate based on the segments created after digest with the specific enzyme or enzymes.
07/08/2014
Cidia Gonzalez / Andee Fonseca
Restriction Enzyme Digest
Lane 1:Empty
Lane 2: 1 kb DNA Ladder
Lane 3: Uncut plasmid pGBR22 (100 ng)
Lane 4: pGBR22 with EcoRI (AndeeF.)
Lane 5: pGBR22 with PvuII (Andee F.)
Lane 6: pGBR22 with EcoRI and PvuII (Andee F.)
Lane 7: pGBR22 with EcoRI (Cidia G.)
Lane 8: pGBR22 with PvuII (Cidia G.)
Lane 9: pGBR22 with EcoRI and PvuII (Cidia G.)
Figure 1. Results of Agarose Gel run of primary PCR samples in lanes 3 and 4 for Andee and Cidia and PCR squared samples in lanes 6-9 for Brianna. A 1 kn ladder is shown in lane 2. The results seen in lanes 3 and 4 are not ideal, but do not suggest failure. Light smears are seen which are not undesired results. However, darker smears would be indicative of concentrations high enough to move on to secondary PCR. The PCR Squared samples seen in lanes 6 through 9 are the desired result with possible contamination or uncompleted assembly of the gene seen in several places in each lane.
Cidia Gonzalez / Andee Fonseca / Xenia Gonzalez
07/08/2014
Primary PCR / PCR Squared
Lane 1: Empty
Lane 2: 1 kb DNA Ladder
Lane 3: Primary PCR Sample (Andee F.)
Lane 4: Primary PCR Sample (Cidia G.)
Lane 5: Empty
Lane 6: PCR Squared KpblaGES5 (Xenia G.)
Lane 7: PCR Squared KpblaGES5 (Xenia G.)
Lane 8: PCR Squared KpblaGES5 (Xenia G.)
Lane 9: PCR Squared KpblaGES5 (Xenia G.)
Wednesday (7/9):
Figure 1. Results of 3rd Primary PCR of Andee’s sample in lane 3 and Cidia’s sample in lane 4. In lane 2 is a 1 kb DNA Ladder. The absence of any result in lane 3 where Andee’s sample should have shown is most likely a result of improper mixing of the sample before PCR. An additional Primary PCR will need to be done in order to get a result viable enough to use in Secondary PCR. The smear seen in lane 4 is the expected result with a high enough yield to continue on to Secondary PCR.
07/09/14
Primary PCR
Andee F. / Cidia G.
Lane 1: Empty
Lane 2: 1 kB DNA Ladder
Lane 3: Primary PCR Sample (Andee F.)
Lane 4. Primary PCR Sample (Cidia G.)
Thursday (7/10)
Figure 1. Secondary PCR samples for Andee, Nikki, Carolyn, and Cidia. The first lane is skipped while the second lane has a 1 kb ladder. Lane three has Andee’s secondary PCR (EhPTP) while the following lanes are Nikki and Carolyn’s secondary PCR and Cidia’s secondary PCR. A visible band is seen for Andee’s samples while the following two samples did not result in bands, indicative that secondary PCR was not successful.
Andee F., Cidia G., Nikki W. and Carolyn T.
07/10/14
Secondary PCR
Lane 1: empty
Lane 2: 1 kb ladder
Lane 3: Andee’s PCR sample
Lane 4: Nikki and Carolyn’s PCR sample
Lane 5: Cidia’s PCR sample
Remaining lanes: empty
Friday (7/11):
Week 5
Andee - good write up. You don't have to have as much procedural detail - instead weight it more towards results. I like the pictures (your protein gel is great and well labelled. The VisLab pics are great! ) - Dr. B6/30/14
Monday:
- Designing Primers: Today, I designed forward and reverse primers to insert EhPTP (protein tyrosine phosphatase of E. histolytica) into E. coli.
- After designing end primers, I created my oligo mix by taking 1 ul out of each of the wells from our ordered DNAworks oligo primers. Each ul was placed into a 1.7 ml microcentrifuge tube by touching the pipette tip to 88 ul of autoclave dH20 that was previously placed in the tube. This amount was determined by subtracting the amount of primers (12) from 100. After adding all of the primers, the mix was pipetted to incorporate all of the samples and then the sample was placed into the -20C freezer.
>filtered DNA sequence with tail endsTACTTCCAATCCATGAAACTGCTGTTCGTTTGCCTGGGTAACATCTGCCGTTCTCCGGCTGCGGAAGCGGTT
ATGAAAAAAGTTATCCAGAACCACCACCTGACCGAAAAATACATCTGTGACTCTGCGGGT
ACCTGCTCTTACCACGAAGGTCAGCAGGCGGACTCTCGTATGCGTAAAGTTGGTAAATCT
CGTGGTTACCAGGTTGACTCTATCTCTCGTCCGGTTGTTTCTTCTGACTTCAAGAACTTT
GACTACATCTTCGCGATGGACAACGACAACTACTACGAACTCCTGGACCGTTGCCCGGAA
CAGTACAAACAGAAAATCTTCAAAATGGTAGACTTCTGCACCACCATCAAAACCACCGAA
GTTCCGGACCCGTACTACGGTGGTGAAAAAGGTTTCCACCGTGTTATCGACATCCTGGAG
GACGCGTGCGAAAACCTGATCATCAAACTGGAAGAAGGTAAACTGATCAACTAACAGTAAAGGTGGATA
Caption: Protein Tyrosine Phosphatase CDS code optimized gene sequence. Leading and lagging strands are shown in bold, start codon is green, stop codon is red, and bases from the gene included in the designed primers are shown underlined. All unedited text is not included in the designed primers.
Forward Primer:
’ TACTTCCAATCCATGAAACTGCTGTTCG ’ 28 bp
Reverse Primer:
’ GGTAAACTGATCAACTAACAGTAAAGGTGGATA ’
Reverse complement:
’ TATCCACCTTTACTGTTAGTTGATCAGTTTACCTTC ’ 36 bp
7/1/14
Tuesday:
7/2/14
Wednesday:
7/3/14
Thursday:
Week 4
Sorry that this week's wikispaces is backwards, Dr. B! I wrote in the order of days in which I could remember what happened!
6/27/14
Friday
Left: The back side of the large panel of monitors that composes the VisLab supercomputer "monitor." Underneath the monitors there are a bundle of wires that connect to approximately 22 computer "cores."
Right: Nikki and Charina attempt to control the pictures on the supermonitor with a large glass control table.
- Drying SDS-PAGE gel: I left early today - not before starting the drying process for my gel, however. I took my gel out from the wash, which did not destain very well since I used new dye. Then I put the gel on Whatman filter paper and covered it with cellophane. I took it over to the dryer and put it under the plastic flap. Next, I turned on the vacuum to remove all air and wrinkles in the plastic to prevent the gel from cracking. Finally I adjusted the drying settings (75C for 2 hours on Gradient cycle) and then started the dryer with mine and Carolyn's gel, along with Andrei and Luis's gel.
AFigure 1. Electrophoresis characterization SDS-Page gel of yopH protein purification before drying (A) and after drying (B). The first and last lanes are empty to prevent "smiling." Lanes 2 - 8 show samples 0 - 6.
Lane 1: ColorPlus Prestained Protein Ladder (10-230 kDa).
Lane 2: Cell lysate before induction
Lane 3: Cell lysate after induction
Lane 4: Soluble fraction
Lane 5: Flow through
Lane 6: Wash
Lane 7: Elution 1
Lane 8: Elution 2
Much contamination is seen in lanes 2-5. Because the band of protein is so dark in elution 2 (lane 8), we could possibly increase the concentration of imidazole in order to release most of the protein in elution 1 when we first begin eluting. We could also decrease the concentration of imidazole in the wash to decrease competition so that weakly bound yopH is not released before eluting. This should concentrate the yopH in the first elution step. In lane 7, elution one is not one distinct band; however, since lane 6 and lane 8 are distinct bands, the distortion is most likely a problem with the sample running through the gel and not contamination.
6/26/14
Thursday:
6/25/14
Wednesday:
6/24/14
Tuesday:
6/23/14
Monday:
Week 3
Yikes - is that first plate bubbles? the other two look good. We should run your pGFP plasmid on a gel whenever you run your next PCR gel - so that we can see if there is a contaminating band present. If so, we probably need ot trash that sample. Dr. BA
Figure 1. LB agar plates with ampicillin containing DH5-alpha cells and varying amounts of pGFP plamid. Transformation density could not be caculated for plates A and C due to overgrowth. Plate B resulted in 518.4 colonies per ng of plasmid.
DNA Re-Sequencing - PMCHERRY 6/18
Caption: Re-sequencing submission of pmcherry DNA plamid using core facility M13for-20 primer.
DNA Re-Sequencing Results - PMCHERRY 6/19
Caption: Re-sequencing results received from the DNA sequencing core facility. Pmcherry was re-sequenced using option A with core facility in-house primer M13_for20 primer and then returned with the above results. The core is going to re-run the sample again using option A and "difficult template buffer."Figure 2. Re-sequencing results seen from the view function of order 104387 PMCHERRY. The several different peaks seen under each base symbol may indicate that the plasmid sample experienced contamination, which resulted in poor results received from the core. Several different plamids being present can "confuse" the sequencer, resulting in the several different colored peaks representing different bases from the different plasmids in the sample.
DNA S/equencing - PGFP 6/18
Caption: DNA sequencing submission of pGFP unverified plasmid using core facility sp6 forward primer.
DNA Sequencing Results - PGFP 6/19
Caption: Sequencing results received from the DNA sequencing core facility. Our plasmid, pGFP, was sequenced using core facility in-house sp6 forward primer with the above results. Currently the sample is being re-run by the core using "difficult template buffer."Week 1 and 2
Figure 1. Absorbance of pmCherry DNA template at 230 nm wavelength using Nanodrop spectrophotometry nucleic acid setting. Trial 1 resulted in pmCherry absorbance of 1.367 and concentration of 109.9 ng/uL using a 10 mm pathway. Wavelength (nm) shown on x-axis and absorbance shown on y-axis.
Figure 2. Absorbance of pmCherry DNA template at 230 nm wavelength using Nanodrop spectrophotometry nucleic acid setting. Trial 2 resulted in pmCherry absorbance of 1.297 and concentration of 108.1 ng/uL using a 10 mm pathway. Wavelength (nm) shown on x-axis and absorbance shown on y-axis.
A
Figure 3. LB-agar plates after overnight incubation period at 37 degrees celsius. Plates contains DH5-alpha bacteria cells with pGFP plasmid on an agar plate with ampicillin. Plates A, B, and C contained 1 ng, 5 ng, and 25 ng of pGFP plasmid, respectively. Ampicillin-resistant colonies experienced substantial growth on all three plates, although they grew the most on plates A and C, which have large cloudy areas of bacterial colonies indistinguishable from one another. Small colonies are visible as whitish-yellow round dots on plate B.
Figure 4. This LB-agar plate with ampicillin contained DH5-alpha bacteria with no DNA plasmid. The plate was incubated overnight at 37 degrees celsius and bacteria did not grow due to their vulnerability to ampicillin antibiotic without pGFP present in their DNA.
DNA SEQUENCING RESULTS - PMCHERRY 6/12
Caption: First received DNA sequencing results from dnaLIMS. Pmcherry was sequenced using M13_for40 primer and was rerun and then returned with the above results.